| siRNA Id: | virsi1882 |
| Sense Sequence: | gcagcuuugacgauggaguagauuu |
| Length: | 25 |
| GC Content (%): | 44 |
| Virus Name: | Epstein-Barr Virus [EBV] |
| Family of Virus: | Herpesviridae |
| Virus Strain: | gD1 |
| Target Gene: | EBNA1 |
| Genbank Accession: | AY961628 |
| Starting Position | 97372 |
| Ending Position: | 97396 |
| Cell Line: | HeLa |
| Concentration: | 10 nM |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 72 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Genolution Pharmaceuticals |
| PubMed: | 19471888 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 0 |
| Structure: | ![]() |
| siRNA sequence matching with Epstein-Barr Virus [EBV] reference genome: | ![]() |
.
.
.
.
.
.
.
.
.
.
.
.
.

