| siRNA Id: | virsi1884 |
| Sense Sequence: | aacucccaauauccaucugcu |
| Length: | 21 |
| GC Content (%): | 43 |
| Virus Name: | Epstein-Barr Virus [EBV] |
| Family of Virus: | Herpesviridae |
| Virus Strain: | EBV |
| Target Gene: | LMP2A |
| Genbank Accession: | X81780 |
| Starting Position | 82 |
| Ending Position: | 102 |
| Cell Line: | IBL-1 |
| Transfection Method: | Oligofectamine |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Dhamacon |
| PubMed: | 18230756 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 75 |
| Structure: |  |
| siRNA sequence matching with Epstein-Barr Virus [EBV] reference genome: |  |
| mRNA1 % inhibition: | 75 |
| mRNA1 Detection Method: | NF-Kappa B Activity (RLU) |
| Protein1: | LMP2A |
| Protein1 % inhibition: | 85 |
| Protein1 Detection Method: | Immunoblotting |
.
.
.
.
.
.
.
.
.
.
.
.
.