siRNA Id: | virsi1884 |
Sense Sequence: | aacucccaauauccaucugcu |
Length: | 21 |
GC Content (%): | 43 |
Virus Name: | Epstein-Barr Virus [EBV] |
Family of Virus: | Herpesviridae |
Virus Strain: | EBV |
Target Gene: | LMP2A |
Genbank Accession: | X81780 |
Starting Position | 82 |
Ending Position: | 102 |
Cell Line: | IBL-1 |
Transfection Method: | Oligofectamine |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Dhamacon |
PubMed: | 18230756 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 75 |
Structure: | |
siRNA sequence matching with Epstein-Barr Virus [EBV] reference genome: | |
mRNA1 % inhibition: | 75 |
mRNA1 Detection Method: | NF-Kappa B Activity (RLU) |
Protein1: | LMP2A |
Protein1 % inhibition: | 85 |
Protein1 Detection Method: | Immunoblotting |
.
.
.
.
.
.
.
.
.
.
.
.
.