| siRNA Id: | virsi1911 |
| Sense Sequence: | gucggucgagaauacgcugug |
| Length: | 21 |
| GC Content (%): | 57 |
| Virus Name: | Herpes Simplex Virus [HSV] |
| Family of Virus: | Herpesviridae |
| Virus Strain: | HHV-6 |
| Target Gene: | U51 |
| Genbank Accession: | AB021506 |
| Starting Position | 83768 |
| Ending Position: | 83788 |
| Cell Line: | SupT1 |
| Concentration: | MOI Of 0.1 TCID50/Cell |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Expressed |
| PubMed: | 16140767 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 80 |
| Structure: |  |
| Target mRNA1: | U51 |
| mRNA1 % inhibition: | High |
| mRNA1 Detection Method: | Real-Time PCR |
| Protein1: | U51 |
| Protein1 % inhibition: | 85 |
| Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.