| siRNA Id: | virsi1925 |
| Sense Sequence: | ggcaucagugugcucaguuga |
| Length: | 21 |
| GC Content (%): | 52 |
| Virus Name: | Ebolavirus [EBOV] |
| Family of Virus: | Filoviridae |
| Virus Strain: | Z EBOV |
| Target Gene: | ZNP |
| Genbank Accession: | J04337 |
| Starting Position | 438 |
| Ending Position: | 458 |
| Cell Line: | 293T |
| Concentration: | 0.5 μg |
| Transfection Method: | TransIT-LT1 |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Expressed |
| siRNA design algorithm used: | siRNAwizard |
| PubMed: | 17940974 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | Low |
| Structure: |  |
| siRNA sequence matching with Ebolavirus [EBOV] reference genome: |  |
| mRNA1 % inhibition: | Low |
| mRNA1 Detection Method: | CAT Assay |
.
.
.
.
.
.
.
.
.
.
.
.
.