| siRNA Id: | virsi1931 |
| Sense Sequence: | aaagaaguacuaucagauugaccaacc |
| Length: | 27 |
| GC Content (%): | 37 |
| Virus Name: | Henipavirus |
| Family of Virus: | Paramyxoviridae |
| Virus Strain: | Niv |
| Target Gene: | L |
| Genbank Accession: | AJ564622 |
| Starting Position | 17609 |
| Ending Position: | 17635 |
| Cell Line: | BHK-21 |
| Concentration: | 50 nM |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 24 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Dhamacon |
| PubMed: | 18687361 |
| Target Object (mRNA,Protein,etc): | Cell Count |
| Silencing Efficacy : | Low |
| Structure: |  |
| siRNA sequence matching with Henipavirus reference genome: |  |
| mRNA1 % inhibition: | Low |
| mRNA1 Detection Method: | Syncytia Number Reduction |
.
.
.
.
.
.
.
.
.
.
.
.
.