virsi1933 details

siRNA Id:virsi1933
Sense Sequence: aaagagagucaauccguucuu
Length: 21
GC Content (%):38
Virus Name:Henipavirus
Family of Virus:Paramyxoviridae
Virus Strain:Niv
Target Gene:N
Genbank Accession: AJ564622
Starting Position 712
Ending Position: 732
Cell Line: BHK-21
Concentration: 50 nM
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 24
siRNA Expression Method: Chemically Synthesized
siRNA design algorithm used: Dhamacon
PubMed:18687361
Target Object (mRNA,Protein,etc): Cell Count
Silencing Efficacy :60
Structure:
siRNA sequence matching with Henipavirus reference genome:
mRNA1 % inhibition:60
mRNA1 Detection Method: Syncytia Number Reduction

.
.
.
.
.
.
.
.
.
.
.

.

.

.