| siRNA Id: | virsi1937 |
| Sense Sequence: | aacaugcaggcaagagaagcc |
| Length: | 21 |
| GC Content (%): | 52 |
| Virus Name: | Hendra Virus |
| Family of Virus: | Paramyxoviridae |
| Virus Strain: | Hev |
| Target Gene: | N |
| Genbank Accession: | AF017149 |
| Starting Position | 1331 |
| Ending Position: | 1351 |
| Cell Line: | BHK-21 |
| Concentration: | 50 nM |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 24 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Dhamacon |
| PubMed: | 18687361 |
| Target Object (mRNA,Protein,etc): | Cell Count |
| Silencing Efficacy : | Medium |
| Structure: |  |
| siRNA sequence matching with Hendra Virus reference genome: |  |
| mRNA1 % inhibition: | Medium |
| mRNA1 Detection Method: | Syncytia Number Reduction |
.
.
.
.
.
.
.
.
.
.
.
.
.