| siRNA Id: | virsi1951 |
| Sense Sequence: | uccuacuguucaagccuccaa |
| Length: | 21 |
| GC Content (%): | 48 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Target Gene: | C |
| Genbank Accession: | HQ641710 |
| Starting Position | 42 |
| Ending Position: | 62 |
| Cell Line: | HepG2 2.2.15 |
| Concentration: | 4 μg (Sir Vector) |
| Transfection Method: | Magnetic Nanoparticles |
| Incubation Time (Hours): | 48 |
| siRNA design algorithm used: | Genscript |
| PubMed: | 20622325 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | High |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| RNA % inhibition: | High |
| RNA Detection method: | RT-PCR |
| Protein1: | HBcAg |
| Protein1 % inhibition: | High |
| Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.