siRNA Id: | virsi1951 |
Sense Sequence: | uccuacuguucaagccuccaa |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | Hepatitis B Virus [HBV] |
Family of Virus: | Hepadnaviridae |
Target Gene: | C |
Genbank Accession: | HQ641710 |
Starting Position | 42 |
Ending Position: | 62 |
Cell Line: | HepG2 2.2.15 |
Concentration: | 4 μg (Sir Vector) |
Transfection Method: | Magnetic Nanoparticles |
Incubation Time (Hours): | 48 |
siRNA design algorithm used: | Genscript |
PubMed: | 20622325 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | High |
Structure: | ![]() |
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | ![]() |
RNA % inhibition: | High |
RNA Detection method: | RT-PCR |
Protein1: | HBcAg |
Protein1 % inhibition: | High |
Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.