| siRNA Id: | virsi1952 |
| Sense Sequence: | agucuagacucgugguggacu |
| Length: | 21 |
| GC Content (%): | 52 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Target Gene: | S |
| Genbank Accession: | HQ641713 |
| Starting Position | 91 |
| Ending Position: | 111 |
| Cell Line: | Huh-7 |
| Concentration: | 1 μg (Vector) |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 96 |
| siRNA Expression Method: | Expressed |
| PubMed: | 20696079 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 81 |
| Structure: | ![]() |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | ![]() |
| RNA % inhibition: | 81 |
| RNA Detection method: | RT-PCR |
| Protein1: | HBeAg |
| Protein1 % inhibition: | 95 |
| Protein1 Detection Method: | S/CO Value (Serum) |
.
.
.
.
.
.
.
.
.
.
.
.
.

