siRNA Id: | virsi1954 |
Sense Sequence: | gcacuucgcuucaccucugca |
Length: | 21 |
GC Content (%): | 57 |
Virus Name: | Hepatitis B Virus [HBV] |
Family of Virus: | Hepadnaviridae |
Target Gene: | S |
Genbank Accession: | FJ589068 |
Starting Position | 1526 |
Ending Position: | 1546 |
Cell Line: | Huh-7 |
Concentration: | 1 μg (Vector) |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 96 |
siRNA Expression Method: | Expressed |
PubMed: | 20696079 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 79 |
Structure: | ![]() |
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | ![]() |
RNA % inhibition: | 78.5 |
RNA Detection method: | RT-PCR |
Protein1: | HBeAg |
Protein1 % inhibition: | 95 |
Protein1 Detection Method: | S/CO Value (Serum) |
.
.
.
.
.
.
.
.
.
.
.
.
.