siRNA Id: | virsi1957 |
Sense Sequence: | aaagcucaucggaacugacaau |
Length: | 22 |
GC Content (%): | 41 |
Virus Name: | Hepatitis B Virus [HBV] |
Family of Virus: | Hepadnaviridae |
Virus Strain: | adw |
Target Gene: | PRE |
Genbank Accession: | AM282986 |
Starting Position | 1317 |
Ending Position: | 1338 |
Cell Line: | COS-7 |
Concentration: | 95 ng (Vector) |
Transfection Method: | FuGENE |
Incubation Time (Hours): | 48 |
siRNA design algorithm used: | siExplorer, siDirect, siRNA Target Designer Programmes & Reynolds |
PubMed: | 20822550 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 77 |
Structure: | ![]() |
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | ![]() |
Protein1: | PRE |
Protein1 % inhibition: | 77 |
Protein1 Detection Method: | Luciferase Assay |
.
.
.
.
.
.
.
.
.
.
.
.
.