| siRNA Id: | virsi1958 |
| Sense Sequence: | aacugacaauucugucguccu |
| Length: | 21 |
| GC Content (%): | 43 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Virus Strain: | adw |
| Target Gene: | PRE |
| Genbank Accession: | AM282986 |
| Starting Position | 1329 |
| Ending Position: | 1349 |
| Cell Line: | COS-7 |
| Concentration: | 95 ng (Vector) |
| Transfection Method: | FuGENE |
| Incubation Time (Hours): | 48 |
| siRNA design algorithm used: | siExplorer, siDirect, siRNA Target Designer Programmes & Reynolds |
| PubMed: | 20822550 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 0 |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Protein1: | PRE |
| Protein1 % inhibition: | Low |
| Protein1 Detection Method: | Luciferase Assay |
.
.
.
.
.
.
.
.
.
.
.
.
.