| siRNA Id: | virsi1983 |
| Sense Sequence: | cauacccuccuguuuaacauc |
| Length: | 21 |
| GC Content (%): | 43 |
| Virus Name: | Hepatitis C Virus [HCV] |
| Family of Virus: | Flaviviridae |
| Virus Strain: | Genotype 1b |
| Target Gene: | NS4B |
| Genbank Accession: | AJ242654 |
| Starting Position | 4150 |
| Ending Position: | 4170 |
| Cell Line: | Huh-7 |
| Concentration: | 10-100 nM |
| Transfection Method: | RNAiMAX |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Yiu 2005 |
| PubMed: | 20534349 |
| Target Object (mRNA,Protein,etc): | RNA |
| Silencing Efficacy : | Low |
| Structure: | ![]() |
| siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: | ![]() |
| RNA % inhibition: | Low |
| RNA Detection method: | Q-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.

