siRNA Id: | virsi1986 |
Sense Sequence: | ggaugauccugaugacucauu |
Length: | 21 |
GC Content (%): | 43 |
Virus Name: | Hepatitis C Virus [HCV] |
Family of Virus: | Flaviviridae |
Virus Strain: | Genotype 1b |
Target Gene: | NS5B |
Genbank Accession: | AJ242654 |
Starting Position | 7259 |
Ending Position: | 7279 |
Cell Line: | Huh-7 |
Concentration: | 10-100 nM |
Transfection Method: | RNAiMAX |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Yiu 2005 |
PubMed: | 20534349 |
Target Object (mRNA,Protein,etc): | RNA |
Silencing Efficacy : | Low |
Structure: | |
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: | |
RNA % inhibition: | Low |
RNA Detection method: | Q-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.