virsi1987 details

siRNA Id:virsi1987
Sense Sequence: uguggugccuacuccuacuuu
Length: 21
GC Content (%):48
Virus Name:Hepatitis C Virus [HCV]
Family of Virus:Flaviviridae
Virus Strain:Genotype 1b
Target Gene:NS5B
Genbank Accession: AJ242654
Starting Position 7712
Ending Position: 7732
Cell Line: Huh-7
Concentration: 10-100 nM
Transfection Method: RNAiMAX
Incubation Time (Hours): 48
siRNA Expression Method: Chemically Synthesized
siRNA design algorithm used: Yiu 2005
PubMed:20534349
Target Object (mRNA,Protein,etc): RNA
Silencing Efficacy :Low
Structure:
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome:
RNA % inhibition:Low
RNA Detection method:Q-PCR

.
.
.
.
.
.
.
.
.
.
.

.

.

.