virsi1990 details

siRNA Id:virsi1990
Sense Sequence: gggaccaagaccuaaucagac
Length: 21
GC Content (%):52
Virus Name:SARS Coronavirus
Family of Virus:Coronaviridae
Virus Strain:HKU-39849
Target Gene:N
Genbank Accession: AY278491
Starting Position 863
Ending Position: 883
Cell Line: HEK 293
Transfection Method: Profectin
Incubation Time (Hours): 48
siRNA Expression Method: Expressed
PubMed:21317844
Target Object (mRNA,Protein,etc): mRNA
Silencing Efficacy :High
Structure:
siRNA sequence matching with SARS Coronavirus reference genome:
Target mRNA1:N
mRNA1 % inhibition:High
mRNA1 Detection Method:RT-PCR
Protein1:N
Protein1 % inhibition:75
Protein1 Detection Method:Western Blotting

.
.
.
.
.
.
.
.
.
.
.

.

.

.