siRNA Id: | virsi1991 |
Sense Sequence: | ggagcuucugcugauucaacu |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | SARS Coronavirus |
Family of Virus: | Coronaviridae |
Virus Strain: | HKU-39849 |
Target Gene: | N |
Genbank Accession: | AY278491 |
Starting Position | 1240 |
Ending Position: | 1260 |
Cell Line: | HEK 293 |
Transfection Method: | Profectin |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Expressed |
PubMed: | 21317844 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | High |
Structure: | ![]() |
siRNA sequence matching with SARS Coronavirus reference genome: | ![]() |
Protein1: | N |
Protein1 % inhibition: | 75 |
Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.