| siRNA Id: | virsi1992 |
| Sense Sequence: | gggugacuggcgggauugcgau |
| Length: | 22 |
| GC Content (%): | 64 |
| Virus Name: | SARS Coronavirus |
| Family of Virus: | Coronaviridae |
| Virus Strain: | HKU-39849 |
| Target Gene: | M |
| Genbank Accession: | AY278491 |
| Starting Position | 221 |
| Ending Position: | 242 |
| Cell Line: | HEK 293 |
| Transfection Method: | Profectin |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Expressed |
| PubMed: | 20956884 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 50 |
| Structure: |  |
| siRNA sequence matching with SARS Coronavirus reference genome: |  |
| Target mRNA1: | M |
| mRNA1 % inhibition: | 50 |
| mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.