virsi2002 details

siRNA Id:virsi2002
Sense Sequence: cuaaaccccaaagaaaaacc
Length: 20
GC Content (%):40
Virus Name:Hepatitis C Virus [HCV]
Family of Virus:Flaviviridae
Virus Strain:HCR6
Target Gene:5'UTR
Genbank Accession: AY045702
Starting Position 357
Ending Position: 376
Cell Line: R6FLR-N
Concentration: 1 nM
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 48
siRNA Expression Method: Chemically Synthesized
siRNA design algorithm used: Ambion
PubMed:16496015
Target Object (mRNA,Protein,etc): Protein
Silencing Efficacy :62
Structure:
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome:
Protein1:5'UTR
Protein1 % inhibition:62
Protein1 Detection Method:Luciferase Assay

.
.
.
.
.
.
.
.
.
.
.

.

.

.