| siRNA Id: | virsi2004 |
| Sense Sequence: | gagugucgugcagccuccag |
| Length: | 20 |
| GC Content (%): | 65 |
| Virus Name: | Hepatitis C Virus [HCV] |
| Family of Virus: | Flaviviridae |
| Virus Strain: | HCR6 |
| Target Gene: | 5'UTR |
| Genbank Accession: | AY045702 |
| Starting Position | 100 |
| Ending Position: | 119 |
| Cell Line: | R6FLR-N |
| Concentration: | 1 nM |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Ambion |
| PubMed: | 16496015 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 60 |
| Structure: | ![]() |
| siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: | ![]() |
| Protein1: | 5'UTR |
| Protein1 % inhibition: | 60 |
| Protein1 Detection Method: | Luciferase Assay |
.
.
.
.
.
.
.
.
.
.
.
.
.

