| siRNA Id: | virsi2016 |
| Sense Sequence: | aagucuuuagggucuucuaccu |
| Length: | 22 |
| GC Content (%): | 41 |
| Virus Name: | John Cunningham Virus [JCV] |
| Family of Virus: | Bunyaviridae |
| Virus Strain: | Mad-1 |
| Target Gene: | T-Ag |
| Genbank Accession: | NC_001699 |
| Starting Position | 4256 |
| Ending Position: | 4276 |
| Cell Line: | Human Primary Fetal Astrocytes |
| siRNA Expression Method: | Chemically Synthesized |
| PubMed: | 15194802 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | Medium |
| Structure: |  |
| siRNA sequence matching with John Cunningham Virus [JCV] reference genome: |  |
| Protein1: | T Antigen |
| Protein1 % inhibition: | Medium |
| Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.