| siRNA Id: | virsi2021 |
| Sense Sequence: | aagcccuauaacaucaaauucaa |
| Length: | 23 |
| GC Content (%): | 30 |
| Virus Name: | Human Respiratory Syncytial Virus [HRSV] |
| Family of Virus: | Paramyxoviridae |
| Target Gene: | P |
| Genbank Accession: | AF035006 |
| Cell Line: | Mouse Eye |
| siRNA Expression Method: | Chemically Synthesized |
| PubMed: | 17050596 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | High |
| Structure: |  |
| siRNA sequence matching with Human Respiratory Syncytial Virus [HRSV] reference genome: |  |
| Protein1: | P |
| Protein1 % inhibition: | High |
| Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.