siRNA Id: | virsi2023 |
Sense Sequence: | ggcagcaauucauugaguaug |
Length: | 21 |
GC Content (%): | 43 |
Virus Name: | Human Respiratory Syncytial Virus [HRSV] |
Family of Virus: | Paramyxoviridae |
Target Gene: | NS1 |
Genbank Accession: | AF035006 |
Cell Line: | Rat Lung |
siRNA Expression Method: | Expressed |
PubMed: | 17270047 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | Medium |
Structure: | ![]() |
siRNA sequence matching with Human Respiratory Syncytial Virus [HRSV] reference genome: | ![]() |
Protein1: | NS1 |
Protein1 % inhibition: | Medium |
Protein1 Detection Method: | Immunofluorescence |
.
.
.
.
.
.
.
.
.
.
.
.
.