| siRNA Id: | virsi2023 |
| Sense Sequence: | ggcagcaauucauugaguaug |
| Length: | 21 |
| GC Content (%): | 43 |
| Virus Name: | Human Respiratory Syncytial Virus [HRSV] |
| Family of Virus: | Paramyxoviridae |
| Target Gene: | NS1 |
| Genbank Accession: | AF035006 |
| Cell Line: | Rat Lung |
| siRNA Expression Method: | Expressed |
| PubMed: | 17270047 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | Medium |
| Structure: |  |
| siRNA sequence matching with Human Respiratory Syncytial Virus [HRSV] reference genome: |  |
| Protein1: | NS1 |
| Protein1 % inhibition: | Medium |
| Protein1 Detection Method: | Immunofluorescence |
.
.
.
.
.
.
.
.
.
.
.
.
.