siRNA Id: | virsi2137 |
Sense Sequence: | aacgagguuacuaccacacac |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | Hepatitis C Virus [HCV] |
Family of Virus: | Flaviviridae |
Virus Strain: | Isolate Con1 |
Target Gene: | NS3 |
Genbank Accession: | AJ238799 |
Starting Position | 8373 |
Ending Position: | 8393 |
Cell Line: | Huh-7 |
Concentration: | 100nM |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 72 |
siRNA Expression Method: | Expressed |
siRNA design algorithm used: | Ambion |
PubMed: | 16979254 |
Target Object (mRNA,Protein,etc): | RNA |
Silencing Efficacy : | 63 |
Structure: | |
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: | |
RNA % inhibition: | 63.4 |
RNA Detection method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.