| siRNA Id: | virsi2140 |
| Sense Sequence: | aaaggacguccggaaccuauc |
| Length: | 21 |
| GC Content (%): | 52 |
| Virus Name: | Hepatitis C Virus [HCV] |
| Family of Virus: | Flaviviridae |
| Virus Strain: | Isolate Con1 |
| Target Gene: | NS4B |
| Genbank Accession: | AJ238799 |
| Starting Position | 11048 |
| Ending Position: | 11068 |
| Cell Line: | Huh-7 |
| Concentration: | 100nM |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 72 |
| siRNA Expression Method: | Expressed |
| siRNA design algorithm used: | Ambion |
| PubMed: | 16979254 |
| Target Object (mRNA,Protein,etc): | RNA |
| Silencing Efficacy : | 30 |
| Structure: |  |
| siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: |  |
| RNA % inhibition: | 30 |
| RNA Detection method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.