| siRNA Id: | virsi2145 |
| Sense Sequence: | aacaaacaaacagcgaugaa |
| Length: | 20 |
| GC Content (%): | 35 |
| Virus Name: | West Nile Virus [WNV] |
| Family of Virus: | Flaviviridae |
| Target Gene: | CAP |
| Genbank Accession: | NC_001563 |
| Cell Line: | 293T |
| Transfection Method: | TransIT-LT1 |
| siRNA Expression Method: | Expressed |
| PubMed: | 12954218 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | Medium |
| Structure: |  |
| siRNA sequence matching with West Nile Virus [WNV] reference genome: |  |
| Protein1: | CAP |
| Protein1 % inhibition: | Medium |
| Protein1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.