| siRNA Id: | virsi2146 |
| Sense Sequence: | cagagccauuugguucaugug |
| Length: | 21 |
| GC Content (%): | 48 |
| Virus Name: | West Nile Virus [WNV] |
| Family of Virus: | Flaviviridae |
| Target Gene: | NS5 |
| Genbank Accession: | NC_001563 |
| Cell Line: | 293T |
| Transfection Method: | TransIT-LT1 |
| siRNA Expression Method: | Expressed |
| PubMed: | 12954218 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | High |
| Structure: |  |
| siRNA sequence matching with West Nile Virus [WNV] reference genome: |  |
| Protein1: | NS5 |
| Protein1 % inhibition: | High |
| Protein1 Detection Method: | FACS |
.
.
.
.
.
.
.
.
.
.
.
.
.