siRNA Id: | virsi2147 |
Sense Sequence: | ggucgaaacgccuaucagaaa |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | Human Metapneumovirus |
Family of Virus: | Paramyxoviridae |
Target Gene: | M |
Genbank Accession: | NC_004148 |
Cell Line: | 293T |
Transfection Method: | TransIT-LT1 |
siRNA Expression Method: | Expressed |
PubMed: | 12954218 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | Medium |
Structure: | ![]() |
siRNA sequence matching with Human Metapneumovirus reference genome: | ![]() |
Protein1: | M |
Protein1 % inhibition: | Medium |
Protein1 Detection Method: | FACS |
.
.
.
.
.
.
.
.
.
.
.
.
.