siRNA Id: | virsi2152 |
Sense Sequence: | gggcagaacugcggcuaucgc |
Length: | 21 |
GC Content (%): | 67 |
Virus Name: | Hepatitis C Virus [HCV] |
Family of Virus: | Flaviviridae |
Target Gene: | NS5B |
Genbank Accession: | nM_012526 |
Cell Line: | Huh-7 |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 72 |
siRNA Expression Method: | Expressed |
PubMed: | 12594341 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | Low |
Structure: | |
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: | |
Protein1: | NS5B |
Protein1 % inhibition: | Low |
Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.