| siRNA Id: | virsi2152 |
| Sense Sequence: | gggcagaacugcggcuaucgc |
| Length: | 21 |
| GC Content (%): | 67 |
| Virus Name: | Hepatitis C Virus [HCV] |
| Family of Virus: | Flaviviridae |
| Target Gene: | NS5B |
| Genbank Accession: | nM_012526 |
| Cell Line: | Huh-7 |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 72 |
| siRNA Expression Method: | Expressed |
| PubMed: | 12594341 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | Low |
| Structure: |  |
| siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: |  |
| Protein1: | NS5B |
| Protein1 % inhibition: | Low |
| Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.