| siRNA Id: | virsi2176 |
| Sense Sequence: | aguaugguauggaucucuag |
| Length: | 20 |
| GC Content (%): | 40 |
| Virus Name: | BK Polyomavirus |
| Family of Virus: | Polyomaviridae |
| Target Gene: | T-Ag |
| Genbank Accession: | V01109 |
| Cell Line: | PrPC |
| Transfection Method: | Oligofectamine |
| siRNA Expression Method: | Chemically Synthesized |
| PubMed: | 17218949 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | High |
| Structure: | ![]() |
| siRNA sequence matching with BK Polyomavirus reference genome: | ![]() |
| Protein1: | T-Ag |
| Protein1 % inhibition: | High |
| Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.

