virsi2177 details

siRNA Id:virsi2177
Sense Sequence: cccccccucccgggagagcc
Length: 20
GC Content (%):85
Virus Name:Hepatitis C Virus [HCV]
Family of Virus:Flaviviridae
Target Gene:C
Genbank Accession: NC_004102
Cell Line: Huh-7
Concentration: 60 nM
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 48
siRNA Expression Method: Chemically Synthesized
PubMed:16566896
Target Object (mRNA,Protein,etc): mRNA
Silencing Efficacy :90
Structure:
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome:
Target mRNA1:Core
mRNA1 % inhibition:90
mRNA1 Detection Method:RT-PCR

.
.
.
.
.
.
.
.
.
.
.

.

.

.