siRNA Id: | virsi2179 |
Sense Sequence: | agaccgugcaccaugagcac |
Length: | 20 |
GC Content (%): | 60 |
Virus Name: | Hepatitis C Virus [HCV] |
Family of Virus: | Flaviviridae |
Target Gene: | C |
Genbank Accession: | NC_004102 |
Cell Line: | Huh-7 |
Concentration: | 60 nM |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Chemically Synthesized |
PubMed: | 16566896 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 90 |
Structure: | ![]() |
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: | ![]() |
Target mRNA1: | Core |
mRNA1 % inhibition: | 90 |
mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.