siRNA Id: | virsi2182 |
Sense Sequence: | aacugcgacgugagguauaug |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | Human Papillomavirus [HPV] |
Family of Virus: | Papillomaviridae |
Virus Strain: | 16 |
Target Gene: | E6 |
Genbank Accession: | NC_001526 |
Cell Line: | Upci:Scc090 |
Transfection Method: | Oligofectamine |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Chemically Synthesized |
PubMed: | 15763658 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | High |
Structure: | |
siRNA sequence matching with Human Papillomavirus [HPV] reference genome: | |
Target mRNA1: | E6 |
mRNA1 % inhibition: | High |
mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.