| siRNA Id: | virsi2182 |
| Sense Sequence: | aacugcgacgugagguauaug |
| Length: | 21 |
| GC Content (%): | 48 |
| Virus Name: | Human Papillomavirus [HPV] |
| Family of Virus: | Papillomaviridae |
| Virus Strain: | 16 |
| Target Gene: | E6 |
| Genbank Accession: | NC_001526 |
| Cell Line: | Upci:Scc090 |
| Transfection Method: | Oligofectamine |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Chemically Synthesized |
| PubMed: | 15763658 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | High |
| Structure: |  |
| siRNA sequence matching with Human Papillomavirus [HPV] reference genome: |  |
| Target mRNA1: | E6 |
| mRNA1 % inhibition: | High |
| mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.