| siRNA Id: | virsi2216 |
| Sense Sequence: | ggaccaaaagaaacaccaucc |
| Length: | 21 |
| GC Content (%): | 48 |
| Virus Name: | Hepatitis C Virus [HCV] |
| Family of Virus: | Flaviviridae |
| Virus Strain: | 3a |
| Target Gene: | C |
| Genbank Accession: | EU266536. |
| Cell Line: | Huh-7 |
| Concentration: | 40 μM/ well |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Ambion |
| PubMed: | 17112601 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 90 |
| Structure: |  |
| siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: |  |
| Protein1: | Core |
| Protein1 % inhibition: | 90 |
| Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.