siRNA Id: | virsi2217 |
Sense Sequence: | gguuuggguaaagucaucgau |
Length: | 21 |
GC Content (%): | 43 |
Virus Name: | Hepatitis C Virus [HCV] |
Family of Virus: | Flaviviridae |
Virus Strain: | 3a |
Target Gene: | C |
Genbank Accession: | EU266536 |
Cell Line: | Huh-7 |
Concentration: | 40 μM/well |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Ambion |
PubMed: | 17112601 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 76 |
Structure: | ![]() |
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: | ![]() |
Protein1: | Core |
Protein1 % inhibition: | 76 |
Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.