| siRNA Id: | virsi2218 |
| Sense Sequence: | ggucgcuggggugaccggguc |
| Length: | 21 |
| GC Content (%): | 76 |
| Virus Name: | Hepatitis C Virus [HCV] |
| Family of Virus: | Flaviviridae |
| Virus Strain: | 3a |
| Target Gene: | IRES (5'UTR) |
| Genbank Accession: | EU266536 |
| Cell Line: | Huh-7 |
| Concentration: | 100 μM/Well |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 24 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Ambion |
| PubMed: | 21569449 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 67 |
| Structure: |  |
| siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: |  |
| Target mRNA1: | 5'UTR |
| mRNA1 % inhibition: | 67 |
| mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.