virsi2219 details

siRNA Id:virsi2219
Sense Sequence: gguacccagaaauuugggcg
Length: 20
GC Content (%):55
Virus Name:Hepatitis C Virus [HCV]
Family of Virus:Flaviviridae
Virus Strain:3a
Target Gene:IRES (5'UTR)
Genbank Accession: EU266536
Cell Line: Huh-7
Concentration: 100 μM/well
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 24
siRNA Expression Method: Chemically Synthesized
siRNA design algorithm used: Ambion
PubMed:21569449
Target Object (mRNA,Protein,etc): mRNA
Silencing Efficacy :71
Structure:
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome:
Target mRNA1:5'UTR
mRNA1 % inhibition:71
mRNA1 Detection Method:RT-PCR

.
.
.
.
.
.
.
.
.
.
.

.

.

.