siRNA Id: | virsi2219 |
Sense Sequence: | gguacccagaaauuugggcg |
Length: | 20 |
GC Content (%): | 55 |
Virus Name: | Hepatitis C Virus [HCV] |
Family of Virus: | Flaviviridae |
Virus Strain: | 3a |
Target Gene: | IRES (5'UTR) |
Genbank Accession: | EU266536 |
Cell Line: | Huh-7 |
Concentration: | 100 μM/well |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 24 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Ambion |
PubMed: | 21569449 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 71 |
Structure: | |
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: | |
Target mRNA1: | 5'UTR |
mRNA1 % inhibition: | 71 |
mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.