virsi2222 details

siRNA Id:virsi2222
Sense Sequence: aauugcauaccgcaauguucu
Length: 21
GC Content (%):38
Virus Name:SARS Coronavirus
Family of Virus:Coronaviridae
Virus Strain:HKU-66078
Target Gene:ORF1a, NSP-1
Genbank Accession: AY304494
Starting Position 594
Ending Position: 614
Cell Line: FRhK-4
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 36
siRNA design algorithm used: Elbashir
PubMed:15259899
Target Object (mRNA,Protein,etc): Viral Titer
Silencing Efficacy :60
Structure:
siRNA sequence matching with SARS Coronavirus reference genome:

.
.
.
.
.
.
.
.
.
.
.

.

.

.