| siRNA Id: | virsi2224 |
| Sense Sequence: | aaucacauuugagcuugauga |
| Length: | 21 |
| GC Content (%): | 33 |
| Virus Name: | SARS Coronavirus |
| Family of Virus: | Coronaviridae |
| Virus Strain: | HKU-66078 |
| Target Gene: | ORF1a, NSP-4 |
| Genbank Accession: | AY304494 |
| Starting Position | 2772 |
| Ending Position: | 2792 |
| Cell Line: | FRhK-4 |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 36 |
| siRNA design algorithm used: | Elbashir |
| PubMed: | 15259899 |
| Target Object (mRNA,Protein,etc): | Viral Titer |
| Silencing Efficacy : | 60 |
| Structure: | ![]() |
| siRNA sequence matching with SARS Coronavirus reference genome: | ![]() |
.
.
.
.
.
.
.
.
.
.
.
.
.

