| siRNA Id: | virsi2262 |
| Sense Sequence: | aaccgcuaccguauuggaaac |
| Length: | 21 |
| GC Content (%): | 48 |
| Virus Name: | SARS Coronavirus |
| Family of Virus: | Coronaviridae |
| Virus Strain: | HKU-66078 |
| Target Gene: | ORF5, M-Protein |
| Genbank Accession: | AY304494 |
| Starting Position | 26968 |
| Ending Position: | 26988 |
| Cell Line: | FRhK-4 |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 36 |
| siRNA design algorithm used: | Elbashir |
| PubMed: | 15259899 |
| Target Object (mRNA,Protein,etc): | Viral Titer |
| Silencing Efficacy : | High |
| Structure: |  |
| siRNA sequence matching with SARS Coronavirus reference genome: |  |
.
.
.
.
.
.
.
.
.
.
.
.
.