siRNA Id: | virsi2262 |
Sense Sequence: | aaccgcuaccguauuggaaac |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | SARS Coronavirus |
Family of Virus: | Coronaviridae |
Virus Strain: | HKU-66078 |
Target Gene: | ORF5, M-Protein |
Genbank Accession: | AY304494 |
Starting Position | 26968 |
Ending Position: | 26988 |
Cell Line: | FRhK-4 |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 36 |
siRNA design algorithm used: | Elbashir |
PubMed: | 15259899 |
Target Object (mRNA,Protein,etc): | Viral Titer |
Silencing Efficacy : | High |
Structure: | ![]() |
siRNA sequence matching with SARS Coronavirus reference genome: | ![]() |
.
.
.
.
.
.
.
.
.
.
.
.
.