virsi2264 details

siRNA Id:virsi2264
Sense Sequence: aacuugcacuagcacacacuu
Length: 21
GC Content (%):43
Virus Name:SARS Coronavirus
Family of Virus:Coronaviridae
Virus Strain:HKU-66078
Target Gene:ORF7
Genbank Accession: AY304494
Starting Position 27425
Ending Position: 27445
Cell Line: FRhK-4
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 36
siRNA design algorithm used: Elbashir
PubMed:15259899
Target Object (mRNA,Protein,etc): Viral Titer
Silencing Efficacy :High
Structure:
siRNA sequence matching with SARS Coronavirus reference genome:

.
.
.
.
.
.
.
.
.
.
.

.

.

.