| siRNA Id: | virsi2269 |
| Sense Sequence: | cgucuaggcccccgaaccac |
| Length: | 20 |
| GC Content (%): | 70 |
| Virus Name: | Encephalomyocarditis Virus |
| Family of Virus: | Picornaviridae |
| Target Gene: | EMCV-IRES |
| Genbank Accession: | NC_001479 |
| Starting Position | 1743 |
| Cell Line: | Huh-7 |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 72 |
| siRNA Expression Method: | Expressed |
| PubMed: | 12594341 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | Low |
| Structure: |  |
| siRNA sequence matching with Encephalomyocarditis Virus reference genome: |  |
| Protein1 % inhibition: | Low |
| Protein1 Detection Method: | Western Blottingting |
.
.
.
.
.
.
.
.
.
.
.
.
.