virsi2270 details

siRNA Id:virsi2270
Sense Sequence: aacacggugggaguaccguau
Length: 21
GC Content (%):52
Virus Name:Chikungunya Virus
Family of Virus:Togaviridae
Virus Strain:DRDE-06
Target Gene:E1
Genbank Accession: EF210157
Starting Position 10018
Ending Position: 10038
Cell Line: Vero
Transfection Method: siPORT
siRNA Expression Method: Chemically Synthesized
siRNA design algorithm used: QIAGEN
PubMed:18805396
Target Object (mRNA,Protein,etc): Viral Titer
Silencing Efficacy :96
Structure:
siRNA sequence matching with Chikungunya Virus reference genome:
RNA % inhibition:94.19
RNA Detection method:RT-PCR

.
.
.
.
.
.
.
.
.
.
.

.

.

.