siRNA Id: | virsi2271 |
Sense Sequence: | aauggccggaguccuuuaaga |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | Chikungunya Virus |
Family of Virus: | Togaviridae |
Virus Strain: | DRDE-06 |
Target Gene: | NSP3 |
Genbank Accession: | EF210157 |
Starting Position | 4194 |
Ending Position: | 4214 |
Cell Line: | Vero |
Transfection Method: | siPORT |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | QIAGEN |
PubMed: | 18805396 |
Target Object (mRNA,Protein,etc): | Viral Titer |
Silencing Efficacy : | 100 |
Structure: | ![]() |
siRNA sequence matching with Chikungunya Virus reference genome: | ![]() |
RNA % inhibition: | 94.91 |
RNA Detection method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.