| siRNA Id: | virsi2271 |
| Sense Sequence: | aauggccggaguccuuuaaga |
| Length: | 21 |
| GC Content (%): | 48 |
| Virus Name: | Chikungunya Virus |
| Family of Virus: | Togaviridae |
| Virus Strain: | DRDE-06 |
| Target Gene: | NSP3 |
| Genbank Accession: | EF210157 |
| Starting Position | 4194 |
| Ending Position: | 4214 |
| Cell Line: | Vero |
| Transfection Method: | siPORT |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | QIAGEN |
| PubMed: | 18805396 |
| Target Object (mRNA,Protein,etc): | Viral Titer |
| Silencing Efficacy : | 100 |
| Structure: |  |
| siRNA sequence matching with Chikungunya Virus reference genome: |  |
| RNA % inhibition: | 94.91 |
| RNA Detection method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.