virsi2276 details

siRNA Id:virsi2276
Sense Sequence: ggcugaucaacaccaacggca
Length: 21
GC Content (%):57
Virus Name:Hepatitis C Virus [HCV]
Family of Virus:Flaviviridae
Virus Strain:1a
Target Gene:E
Genbank Accession: M62321
Cell Line: Huh-7
Incubation Time (Hours): 48
siRNA Expression Method: Silencer siRNA Construction Kit (Ambion).
siRNA design algorithm used: Ambion
PubMed:21535893
Target Object (mRNA,Protein,etc): mRNA
Silencing Efficacy :93
Structure:
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome:
Target mRNA1:E
mRNA1 % inhibition:93
mRNA1 Detection Method:RT-PCR

.
.
.
.
.
.
.
.
.
.
.

.

.

.