| siRNA Id: | virsi2276 |
| Sense Sequence: | ggcugaucaacaccaacggca |
| Length: | 21 |
| GC Content (%): | 57 |
| Virus Name: | Hepatitis C Virus [HCV] |
| Family of Virus: | Flaviviridae |
| Virus Strain: | 1a |
| Target Gene: | E |
| Genbank Accession: | M62321 |
| Cell Line: | Huh-7 |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Silencer siRNA Construction Kit (Ambion). |
| siRNA design algorithm used: | Ambion |
| PubMed: | 21535893 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 93 |
| Structure: | ![]() |
| siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: | ![]() |
| Target mRNA1: | E |
| mRNA1 % inhibition: | 93 |
| mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.

