siRNA Id: | virsi2279 |
Sense Sequence: | ggggucaucgauacccuuacg |
Length: | 21 |
GC Content (%): | 57 |
Virus Name: | Hepatitis C Virus [HCV] |
Family of Virus: | Flaviviridae |
Virus Strain: | 1a |
Target Gene: | C |
Genbank Accession: | M62321 |
Cell Line: | Huh-7 |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Silencer siRNA Construction Kit (Ambion). |
siRNA design algorithm used: | Ambion |
PubMed: | 21535893 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 70 |
Structure: | |
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: | |
Target mRNA1: | C |
mRNA1 % inhibition: | 70 |
mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.