| siRNA Id: | virsi2304 |
| Sense Sequence: | accuucugcugucaguauccg |
| Length: | 21 |
| GC Content (%): | 52 |
| Virus Name: | Lymphocytic Choriomeningitis Virus |
| Family of Virus: | Arenaviridae |
| Target Gene: | Z |
| Genbank Accession: | NC_004291 |
| Cell Line: | HEK 293T |
| Concentration: | 100 nM |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Dharmacon |
| siRNA design algorithm used: | Oligoengine |
| PubMed: | 16103158 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | High |
| Structure: |  |
| siRNA sequence matching with Lymphocytic Choriomeningitis Virus reference genome: |  |
| Protein1: | L |
| Protein1 % inhibition: | High |
| Protein1 Detection Method: | CAT Assay |
.
.
.
.
.
.
.
.
.
.
.
.
.