virsi2314 details

siRNA Id:virsi2314
Sense Sequence: cgguuaaaggcaguaggguug
Length: 21
GC Content (%):52
Virus Name:Semliki Forest Virus
Family of Virus:Togaviridae
Virus Strain:SFV9
Target Gene:NSP
Genbank Accession: AJ251359
Cell Line: U4.4
Concentration: 10 nM
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 24
siRNA Expression Method: Ambion
PubMed:21191029
Target Object (mRNA,Protein,etc): Protein
Silencing Efficacy :79
Structure:
siRNA sequence matching with Semliki Forest Virus reference genome:
Protein1:Hot
Protein1 % inhibition:78.6
Protein1 Detection Method:Luciferase Assay

.
.
.
.
.
.
.
.
.
.
.

.

.

.