| siRNA Id: | virsi2314 |
| Sense Sequence: | cgguuaaaggcaguaggguug |
| Length: | 21 |
| GC Content (%): | 52 |
| Virus Name: | Semliki Forest Virus |
| Family of Virus: | Togaviridae |
| Virus Strain: | SFV9 |
| Target Gene: | NSP |
| Genbank Accession: | AJ251359 |
| Cell Line: | U4.4 |
| Concentration: | 10 nM |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 24 |
| siRNA Expression Method: | Ambion |
| PubMed: | 21191029 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 79 |
| Structure: |  |
| siRNA sequence matching with Semliki Forest Virus reference genome: |  |
| Protein1: | Hot |
| Protein1 % inhibition: | 78.6 |
| Protein1 Detection Method: | Luciferase Assay |
.
.
.
.
.
.
.
.
.
.
.
.
.