siRNA Id: | virsi2316 |
Sense Sequence: | guuuauuaacacuguuuugaa |
Length: | 21 |
GC Content (%): | 24 |
Virus Name: | Semliki Forest Virus |
Family of Virus: | Togaviridae |
Virus Strain: | SFV11 |
Target Gene: | NSP |
Genbank Accession: | AJ251359 |
Cell Line: | U4.4 |
Concentration: | 10 nM |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 24 |
siRNA Expression Method: | Ambion |
PubMed: | 21191029 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 75 |
Structure: | ![]() |
siRNA sequence matching with Semliki Forest Virus reference genome: | ![]() |
Protein1: | Cold |
Protein1 % inhibition: | 75.3 |
Protein1 Detection Method: | Luciferase Assay |
.
.
.
.
.
.
.
.
.
.
.
.
.