virsi2319 details

siRNA Id:virsi2319
Sense Sequence: ugccgaacguggugggguucc
Length: 21
GC Content (%):67
Virus Name:Semliki Forest Virus
Family of Virus:Togaviridae
Virus Strain:SFV14
Target Gene:Polyprotein
Genbank Accession: AJ251359
Cell Line: U4.4
Concentration: 10 nM
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 24
siRNA Expression Method: Ambion
PubMed:21191029
Target Object (mRNA,Protein,etc): Protein
Silencing Efficacy :56
Structure:
siRNA sequence matching with Semliki Forest Virus reference genome:
Protein1:Cold
Protein1 % inhibition:56.3
Protein1 Detection Method:Luciferase Assay

.
.
.
.
.
.
.
.
.
.
.

.

.

.